EST details — SGN-C185934
Search information |
Request: 185934 | Match: SGN-C185934 |
Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
Clone information |
SGN ID: SGN-C185934 | Clone name: TUS-48-K20 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185934 is on microarray TOM1 spot ID 1-1-5.3.7.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C73279 [cLER-4-B19] | Trace: SGN-T92941 | EST: SGN-E278108 | Direction: 5' | Facility: TIGR |
Clone: SGN-C185934 [TUS-48-K20] | Trace: SGN-T188440 | EST: SGN-E376400 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E376401 | Length: 227 bp (938 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E376401 [] (trimmed)
CCGGGCAGGTACCTTGCAGAGTAAGGCTTGCCACTAGGACCAGGGTCTTTCAAGTCATCGATATATTTTTTCAACTTGTCATCCCAGAGCTGGTA
GTTTCCTTCATTGAATGAATAGATCTTTCCAGACTTTGGTATTTGGACATTTTCTTGAGTCAGAACAAATTCTCCATACATTGGATCCAAGTTAA
AGGAAAAAACGCCATTTCCCAAGGTGAGTACCTCGGC
GTTTCCTTCATTGAATGAATAGATCTTTCCAGACTTTGGTATTTGGACATTTTCTTGAGTCAGAACAAATTCTCCATACATTGGATCCAAGTTAA
AGGAAAAAACGCCATTTCCCAAGGTGAGTACCTCGGC
Unigenes |
Current Unigene builds | |||||
[SGN-E376401] | SGN-U583766 | Tomato 200607 | Build 2 | 49 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T188441 [Download][View] | Facility Assigned ID: FA0AAD36BF10RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.878 | Expected Error Rate: 0.0075 | Quality Trim Threshold: 14.5 |