EST details — SGN-C186044
| Search information |
| Request: 186044 | Match: SGN-C186044 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C186044 | Clone name: TUS-48-P10 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C186044 is on microarray TOM1 spot ID 1-1-7.4.7.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C78509 [cLES-5-N9] | Trace: SGN-T98160 | EST: SGN-E285677 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E378657 | Length: 85 bp (1102 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E378657 [] (trimmed - flagged)
GTTCACATTCCGGTAAAAGTTTTTTTCCCAACACCACCAGAACGGGCTGGAATCACCTTCAATACATTGAACCTCACAGTTTTGG
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T1921 [Download][View] | Facility Assigned ID: TUS48P10.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Too short after trimming low-quality bases |
| Sequence Entropy: 0.849 | Expected Error Rate: 0.0286 | Quality Trim Threshold: 20.5 |
Working
