EST details — SGN-C18611

Search information 
Request: 18611Match: SGN-C18611
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C18611Clone name: cLED-24-A5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175980 is on microarray TOM1: SGN-S1-1-7.1.11.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175980 [TUS-22-M2] Trace: SGN-T180580 EST: SGN-E368101 Direction: 3' Facility: INRA
Clone: SGN-C175980 [TUS-22-M2] Trace: SGN-T180581 EST: SGN-E368102 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240878Length: 375 bp (745 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240878 [] (trimmed) TCAGGTGTACAGAATGGATTCAACTGTAAATGCGTTAGCAATGGCTAAGGACCCTGAAGCTGCTTTCTTTAAGAAACTGGATGGCCTTCAACCTT
GTGAGGTCTCAGAACTAAAAGCTGGCACTCACATATTCGCTGTTTATGGAGATAATTTCTTTAAGCCAGCTACTTATATTATTGAGGCTCTTTGT
GCCAAGTCATATGAGGATACTACTGTTAAGCTCAAGGAAATCGAGGCTCAGATTTTGAGGAAGAGAAATGAGCTTCGGCAGTTTGAAATCGAATA
TAGAAAGGCATTGGCACACTTCCAGGAAGTAACCAACAGATACAGCCAAGAGAAGCTGTCTGTCGATGAGATGCTGAAACAAAGAGACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240878] SGN-U574491 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54775 [Download][View] Facility Assigned ID: TOVDO03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0164 Quality Trim Threshold: 14.5