EST details — SGN-C18633

Search information 
Request: 18633Match: SGN-C18633
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C18633Clone name: cLED-24-B6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175989 is on microarray TOM1: SGN-S1-1-6.1.11.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175989 [TUS-22-M11] Trace: SGN-T1381 EST: SGN-E378517 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175989 [TUS-22-M11] Trace: SGN-T180466 EST: SGN-E367852 Direction: 3' Facility: INRA
Clone: SGN-C175989 [TUS-22-M11] Trace: SGN-T180467 EST: SGN-E367853 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240994Length: 212 bp (820 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240994 [] (trimmed) CAGCTTTAGACTCTGATCCTCGTTCTTATGTATTTGGAGAAGATGTTGGTTTTGGTGGTGTCTTTCGTTGCACTACTGGGCTAGCTGACCGATTT
GGTAAACAGAGGGTCTTTAACACTCCTCTGTGTGAGCAGGGCATAGTTGGATTTGCGATTGGTCTTGCTGCAATGGACAATCGAGCTGTAGCAGA
AATTCAATTTGCAGATTATATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240994] SGN-U585832 Tomato 200607 Build 2 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54891 [Download][View] Facility Assigned ID: TOVDR03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0146 Quality Trim Threshold: 14.5