EST details — SGN-C1869

Search information 
Request: 1869Match: SGN-C1869
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1869Clone name: cLEC-14-C20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C185593 is on microarray TOM1: SGN-S1-1-2.1.9.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185593 [TUS-47-M15] Trace: SGN-T192091 EST: SGN-E390765 Direction: 3' Facility: INRA
Clone: SGN-C185593 [TUS-47-M15] Trace: SGN-T192092 EST: SGN-E390766 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204630Length: 399 bp (849 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204630 [] (trimmed) CAGGTTTTCTTGAAAAGGGGTTTTATTTAGTTTCTGAAGCTGAATTGGGTAGAAATTTTGTAAAATGTTTGGATTTTTATGAGATGGGGTTGTTG
AAGATGAGCTTTTTGCAGTGAAGAGTAAGTTTGGGTATAAGCAGAGTATAAATTTAAAGGAATATGGCAACTCCAGTTGAGCCACCAAATGGGAT
AAGGTCCCCAGGGAAACATTACTATTCTATGTGGCAATCCCTTTTTGAAATTGATACTAAATATGTACCTATTAAGCCTATTGGGCGAGGGGCAT
ATGGAATTGTTTGTTCTTCTGTTAACAGGGAATCCAATGAGAAGGTTGCAATCAAGAAAATAAACAATGCTTTTGAGAATCGTGTTGATGCTCTC
AGGACATTGCGTGAACTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204630] SGN-U577288 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26246 [Download][View] Facility Assigned ID: TCACB22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5