EST details — SGN-C19288

Search information 
Request: 19288Match: SGN-C19288
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C19288Clone name: cLED-26-E19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C186209 is on microarray TOM1: SGN-S1-1-2.3.5.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241053Length: 403 bp (761 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E241053 [] (trimmed) GTATGATACTTTTCTACTTTAGAAAAAACATGGAAACGCTAAACAATTACCAGTATTACAAGAAAAAATGTCAATACTCCAGAGCTCAAAAGTAC
TGTTAGTTTGTATAATACTGAAAATGTCAATACATGTATACCAATTCTGAGTACCATATATATTACAATCCGTCCTAATCTACGCGAATTACCTA
ACATTTTTCCCATGTCATAGAGATCACGATTGACAGTTCAGAATTCTTCATATCACCATCATCATACCTATATATGTGTTGCTTCATTTTGATCG
TTCGTTTTCTTATCTCTTGCGTTTGGACTTTAGAGATGTCACAGACTGTGAATTGCTATGCCAATTGCGTTTTCTTTGATTGATGAACCAGTTAT
TGATTTGCTTCAGCTGTAATCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241053] SGN-U563454 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55247 [Download][View] Facility Assigned ID: TOVDW34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5