EST details — SGN-E200341

Search information 
Request: 200341Match: SGN-E200341
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3223Clone name: cLEC-1-K11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183759 is on microarray TOM1: SGN-S1-1-4.1.19.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3223 [cLEC-1-K11] Trace: SGN-T24555 EST: SGN-E200342 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200341Length: 347 bp (839 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200341 [] (trimmed) GAAAGTTTCAAGATGTAATCCTTCCAGATACCTCTCTGGACGATGTGGTGGAACTACCAGAATTGGTGTGCTCGTTGGAGGGATTATTGCTGGAG
CTGGTTTAATGGCTGCTTTGGCTGTTCTTTGCTACTGCATTCGAAGACGTTCTGCATCTCTCAAGAAAAGAATGAGCGCAAGACGCCTTCTCTCT
GAAGCTGCAGGCAGCAACAGTGTTCATGTATTTCAATACAAAGAAATTGAGAGAGCAACAAATAGTTTCTCTGAGAAACAGAGGCTGGGCATAGG
GGCTTATGGCACAGTTTATGCTGGAAAGCTCCACAGTGATGAATGGGTTGCAATTAAGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200341] SGN-U584588 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24554 [Download][View] Facility Assigned ID: TCAAA66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0329 Quality Trim Threshold: 14.5