EST details — SGN-E200342

Search information 
Request: 200342Match: SGN-E200342
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3223Clone name: cLEC-1-K11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183759 is on microarray TOM1: SGN-S1-1-4.1.19.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3223 [cLEC-1-K11] Trace: SGN-T24554 EST: SGN-E200341 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200342Length: 455 bp (960 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E200342 [] (trimmed) TTTTTTTGCAAATACTATTTCACATTCTATATTTCTGCGTATGAAGCAATAAAATTTTTGATACAAAGAGAAGTGCTCTAATAATACTCTTTGAT
ATTCTCAGTAGATTAGAAGGCAGGAAAAGGAGGTGATAGATTACAGGTGATCCCCCTCAGTTTTCTACCTAGAGCGAACTTCTTTTTTCAAGTCA
TCATCGACCAGAATTACCTAATAATCGATTTGTTGAAGGGGGACTCTCTTCACTTAACCAAGGATCCTGTACAGAAACAGGGGAACTGTCTTTTA
TTTCCTCCATGATTGCCAGTGAATTCGCTATCTTCTGGGGAACAATCAACCTCCTACTCCCTACTCCTTTCTTAGTTGTTGTACTACGAAAAGAT
GTCTCACTCATACTACGGGGAGATGAGCAAGAGGAATTCACTGATGAAGTCATGCATACATTGTCCTCCAATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200342] SGN-U584590 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24555 [Download][View] Facility Assigned ID: TCAAA66TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0077 Quality Trim Threshold: 20.5