| SGN ID: SGN-C8067 | Clone name: cLEC-4-D23 |  | Order Clone |
|
| Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: Alias clone
SGN-C180720 is on microarray TOM1: SGN-S1-1-3.2.17.14
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E201505 | Length: 131 bp (520 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E201505 [] (trimmed)
AAATACTATTATTGTTTCACCAATGGCCACTACAAGTGTTTTGGTCTCTTCTTCTTTTCTTCTCATTTTGCTTTCATTCTCTTTGGAGAAAAGCA
ATGCTTTGGTAGGAAGAAAAACAATTGAATCCAATT
[BLAST] [AA Translate]
| SGN-ID: SGN-T24455 [Download][View] |
Facility Assigned ID: TCAAO24TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.878 |
Expected Error Rate: 0.0351 |
Quality Trim Threshold: 14.5 |
