EST details — SGN-E201799

Search information 
Request: 201799Match: SGN-E201799
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1344Clone name: cLEC-11-L9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173062 is on microarray TOM1: SGN-S1-1-5.3.20.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173062 [TUS-15-C12] Trace: SGN-T188632 EST: SGN-E375778 Direction: 3' Facility: INRA
Clone: SGN-C173062 [TUS-15-C12] Trace: SGN-T188633 EST: SGN-E375779 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201799Length: 487 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201799 [] (trimmed) GAAGAGAGGAATTTCATTCCTGTAAAACGTAGGACCAAAAGTTGTAAAAAAAGGCAGCAACAAGTAGAACCTCATACACTAAAATCCACTTCACA
TTCTTCTGCTTCTACTTCAACTCAAACTGATCCTTTATCCATGATTAAGACGGTGCAGTTGGATAGGAAAAAGATGATTCCTAAAAAGCCTAGAA
GTGTTAAATCTAAGGCCAAGCAAGTGAAATCTAATCATCCAAGAAAGGCTGAGAGTCATAGCATCAAAAGGAAGGGGTCAAAGAGGACAAGGATT
AATGACCTTTATGATGACGTTGAAGCTAAATATTCTGTTATGGAGCGAGCAGAAAAGGTTTTATCAAGCCTACCAGATGAATTCCCCAGCTTTGC
AAAGTGTATGCTCCCTTCAAATGTTGCTCATGGATTTTGGTTGCATCTTCCAAAGTCATTCTGCAACATGCATTTACCTAGTTCTGATACCACAG
TCATTTTGGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201799] SGN-U565687 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25746 [Download][View] Facility Assigned ID: TCABQ65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5