Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E201921

Search information 
Request: 201921Match: SGN-E201921
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14183Clone name: cLEC-7-C13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172869 is on microarray TOM1: SGN-S1-1-6.3.20.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195134 EST: SGN-E393808 Direction: 3' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195317 EST: SGN-E393991 Direction: 5' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195592 EST: SGN-E394266 Direction: 5' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195592 EST: SGN-E399526 Direction: 5' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T199612 EST: SGN-E398286 Direction: 3' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T199612 EST: SGN-E398963 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201921Length: 456 bp (768 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201921 [] (trimmed) CAGCCTCGCTCCAAGGATCACCAGTCCGGTTGCTGTAGCTGCTGCTATGGTCGCAAAAAGAAGCATGTTAATACATCAGAAGAACATCGGGCCTT
GCGACGAGGTGATTCAGACGATGAAGAAATGAATCTCTCACTGGCTCCCAAGGCTTTTGGGAACTCAGCAGTTCTTATTGATTCAATTCCTGTGG
CGGAGTTCCAAGGTCGTCCTTTGGCAGATCACCCAGCTGTGAAGAATGGACGGCCTCCTGGTGCTTTGACCATTCCTCGAGAGCATCTTGATGCA
TCAACAGTTGCAGAGGCCATCAGTGTCATCTCCTGCTGGTATGAGGAGAAGACAGAGTGGGGACAACGTGTCGGATGGATTTATGGTTCAGTTAC
TGAAGATGTTGTGACAGGATACAGGATGCACAACAGAGGTTGGAAGTCAGTTTATTGTGTTACCAAACGTGATGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201921] SGN-U567218 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25203 [Download][View] Facility Assigned ID: TCAAY19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5