EST details — SGN-E201931

Search information 
Request: 201931Match: SGN-E201931
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14272Clone name: cLEC-7-G15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172912 is on microarray TOM1: SGN-S1-1-3.1.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195254 EST: SGN-E393928 Direction: 3' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195401 EST: SGN-E394075 Direction: 5' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195698 EST: SGN-E394372 Direction: 5' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195698 EST: SGN-E399092 Direction: 5' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195796 EST: SGN-E394470 Direction: 3' Facility: INRA
Clone: SGN-C172912 [TUS-14-M6] Trace: SGN-T195796 EST: SGN-E399091 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201931Length: 510 bp (768 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201931 [] (trimmed) GTGCCTCTTCGCAAGAAGAGACTCAACCGAATAGTCCCGTCCCACAAGTGCAGCTTGAATATGTTTTTCAATCTGCACTTGCGTATCAACAACGG
AGTCTATCATTTCTTCCCTATAAGCTTTCCCCCATAAAACGGTTCTTAACCTACTCGCGAGCTCCGCTCGACGGGTGTCGTCATCGAGAAGCGGA
GGGTGGAGCTCTGGGATCAGGGGCGGTTGATTATCCTGACCTGGGGTTGGAGCCGACGAGGAAGGTGAATTCCATAGATCCGTTTGGGAAATGGA
ATGAGTAGGGCTCACTTGCTGCACTTCCTCCCCAAGGTCCGGTGCAGGGGACATGTCCGAAAGTCCTCTGAAAAAAGAGGACGACGGGGGAGAGG
CTGATGCGGCGGAGTCATTTTCCTCGGATAAGTTGAGGTACTTTTGCCAATTATCCGACCCCGACCCTGAATCCACCGCCCTTCCTCCAGCGGAA
TTATCCTCCATTTGAAAGCTGCTGCAACCGCCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201931] SGN-U574556 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25213 [Download][View] Facility Assigned ID: TCAAY44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5