EST details — SGN-E201964

Search information 
Request: 201964Match: SGN-E201964
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14192Clone name: cLEC-7-C22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172875 is on microarray TOM1: SGN-S1-1-8.3.20.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T195318 EST: SGN-E393992 Direction: 5' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T195595 EST: SGN-E394269 Direction: 3' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T195595 EST: SGN-E398968 Direction: 3' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T199438 EST: SGN-E398112 Direction: 3' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T199587 EST: SGN-E398261 Direction: 5' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T199587 EST: SGN-E398969 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201964Length: 466 bp (746 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201964 [] (trimmed) TTCAAAATCAATCCAAACAGAGCCTTAACAGGGCCCAAGATAGCTTCTAGTCAAAATCTTACACACAATAAACTCACCACCACAGCGGCAGCAGT
AGCAGACCGGAATCTCCTCCTTCCTCCTCCGTCTGCTCCGCCGTCTTTCTCCGATCAGCCGCCGTCCTCCTCCTTCGCTCCAAAACCGTACTGTT
AACACCGTGGTTTGGCTGTTTGTGTATCAAAATCTCAACTACCAAACAGTCAACAACTACTTATCTACTTATATACAACTACTTTTTCGTGTTTG
TATCAGAGAGGTATAGGAAATGGAGTCGAGTTTGGAGTTGTTGAGATCGATTGAATCGGCATTGGGAGTGTCGTTGGGGAGTGATACGGTGTTGG
TGCTACTTACGACGTCGTTCGCGGTCATCGTTGGATTAGTAGTGTTCTTCTTGAAGAGATCAAGTGATCGAAGTAAAGAAGTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201964] SGN-U581827 Tomato 200607 Build 2 94 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25246 [Download][View] Facility Assigned ID: TCAAZ23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5