EST details — SGN-E201998

Search information 
Request: 201998Match: SGN-E201998
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14401Clone name: cLEC-7-M24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183489 is on microarray TOM1: SGN-S1-1-2.1.1.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183489 [TUS-42-E23] Trace: SGN-T194930 EST: SGN-E393604 Direction: 3' Facility: INRA
Clone: SGN-C183489 [TUS-42-E23] Trace: SGN-T195947 EST: SGN-E394621 Direction: 5' Facility: INRA
Clone: SGN-C183489 [TUS-42-E23] Trace: SGN-T195947 EST: SGN-E399556 Direction: 5' Facility: INRA
Clone: SGN-C183489 [TUS-42-E23] Trace: SGN-T200238 EST: SGN-E399145 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201998Length: 380 bp (741 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201998 [] (trimmed) CAGCTGCGGCACGTCATCTTGCTTCAAGTGGGGTTGATGTATACACAGCAATAGCAGGAGCTGTGGGAGCTTTGTATGGCCCTCTCCATGGGGGT
GCCAATGAGGCTGTGCTGAAAATGCTCAGTGAGATTGGAAGTGTTGAAAATATTCCAGAGTTCCTTGAGGGTGTCAAGAACAGGAAACGAAAGAT
GTCTGGTTTTGGGCACCGTGTCTACAAAAACTATGATCCCAGAGCAAAAGTCATCAAGACGCTGGCCGATGAAGTATTTTCTATTGTGGGTCGTG
ATCCTTTAATTGAGGTTGCTGTTGCTCTGGAAAAAGCTGCACTCTCAGATGAGTACTTTGTAAAACGGAAGCTGTATCCAAACGTTGATTTCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201998] SGN-U578446 Tomato 200607 Build 2 61 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25280 [Download][View] Facility Assigned ID: TCAAZ84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0177 Quality Trim Threshold: 14.5