EST details — SGN-C20204

Search information 
Request: 20204Match: SGN-C20204
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20204Clone name: cLED-29-K5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C183057 is on microarray TOM1: SGN-S1-1-2.3.3.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183057 [TUS-41-C23] Trace: SGN-T191691 EST: SGN-E390365 Direction: 3' Facility: INRA
Clone: SGN-C183057 [TUS-41-C23] Trace: SGN-T197472 EST: SGN-E396146 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239782Length: 468 bp (744 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239782 [] (trimmed) CATCAGCCTGTCAGGAATAACAGTAGGAAGCAAGATCACTGATCTTGATTTCACAGCCATTTTCGACTCTGGCACTTCATTCACATACTTGAACG
ACCCAGTTTACAAAGTCATTACAGAAAACTTCGATTCTGAAGCAAAACAGCCACGTATTCAACCTGATGGCACAATTCCTTTTGAGTACTGCTAT
GGGATAAGTGCAAATCAAACTACATTTGAAGTTCCAGACGTAAATTTGACAATGAAAGGTGGCAACCAATTTTATCTTTTCGATCCGATAATAAT
GCTCTCACTCCCGGACGGTTCAGGCGCATACTGTTTAGCTGTTGTGAAAAGTGGGGATGTCAACATCATTGGACAAAATTTCATGACTGGCTATC
ACGTAATATTTGATCGGGAGAAGATGGTTTTGGGTTGGAAAGCCTCTGATTGTTATGATTCTGGAGAATCAAACGATAGATCAACAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239782] SGN-U574299 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56070 [Download][View] Facility Assigned ID: TOVEI63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5