EST details — SGN-E202064

Search information 
Request: 202064Match: SGN-E202064
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14295Clone name: cLEC-7-H18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172924 is on microarray TOM1: SGN-S1-1-7.1.20.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172924 [TUS-14-M18] Trace: SGN-T195404 EST: SGN-E394078 Direction: 5' Facility: INRA
Clone: SGN-C172924 [TUS-14-M18] Trace: SGN-T195404 EST: SGN-E399095 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202064Length: 466 bp (974 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202064 [] (trimmed) TCAGACGCATCGAGGGGAGTTTATGTGTTCTCTGATATGAACCCTTATGTTGGTCATCCTAATCCTTTAAAAGAAGGGCAAGAATTGTTTCGTAA
GGGTCTCTTAAGTGAAGCAGTTCTTGCTTTGGAGGCTGAAGTCTTGAAGAACCCTGAAAATGCTGAGGGTTGGAGGTTACTTGGCATAGCACATG
CTGAAAACGATGATGATCAACAGGCTATAGCTGCTATGATGCGGGCACAGGAGGCTGATCCCGCAAATTTGGAAGTTCTTCTTTCCCTTGGAGTA
AGTCATACAAATGAACTGGAGCAACAAGCTGCATTGAAGTATTTGTATAGTTGGTTACGCCACCACCCGAAGTATGGGAGTATTGCGCCTCAGGA
GCAGCCCATTTCTTTCTATCATGCTGATGTAGCTAGATTGTTTACAGATGCAGCTCANATGGCACCTGAGGATGCTGACGTACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202064] SGN-U573738 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25346 [Download][View] Facility Assigned ID: TCABB45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5