EST details — SGN-E202215

Search information 
Request: 202215Match: SGN-E202215
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14339Clone name: cLEC-7-J4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183957 is on microarray TOM1: SGN-S1-1-6.1.18.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183957 [TUS-43-I11] Trace: SGN-T196251 EST: SGN-E394925 Direction: 3' Facility: INRA
Clone: SGN-C183957 [TUS-43-I11] Trace: SGN-T196252 EST: SGN-E394926 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202215Length: 525 bp (1006 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202215 [] (trimmed) CCATATGGTACTTTTATTGGAATTTATGATGGACATGGAGGACCTGAAACTTCAAGGTTCATTAATGAACACCTCTTTCAGAATCTCAAGAGGTT
CACATCTGAGCACCAGTCTATGTCTGTTGAGGTTATTCGGAAAGCATTTCAAGCAACAGAAGAAGGTTTCCTCTCTGTTGTGACTAGACAATGGC
CGACGAAACCACAGATTGCTGCTGTTGGATCATGCTGTCTTGTTGGAGTTATCTGCAGTGGAACCTTATATGTAGCCAACCTTGGTGACTCGAGG
GCAGTCTTAGGGAGACTTGTCAGATCAACTGGCGAGGTTCTCGCGATTCAGCTCTCTGCAGAACACAATGTGAGCATTGAATCTGTAAGACAGGA
GATGCAATCTTTGCATCCAGATGATTCACAAATTGTAGTTTTAAAGCACAATGTCTGGCGTGTCAAGGGGCTTATACAGATTTCAAGATCCATTG
GTGATGTGTACTTAAAGAAATCTGAATTCAACAAGGAACCACTGTATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202215] SGN-U568977 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25497 [Download][View] Facility Assigned ID: TCABB50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5