Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E202233

Search information 
Request: 202233Match: SGN-E202233
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10711Clone name: cLEC-6-A3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172628 is on microarray TOM1: SGN-S1-1-7.1.20.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172628 [TUS-14-A10] Trace: SGN-T195201 EST: SGN-E393875 Direction: 3' Facility: INRA
Clone: SGN-C172628 [TUS-14-A10] Trace: SGN-T195202 EST: SGN-E393876 Direction: 5' Facility: INRA
Clone: SGN-C172628 [TUS-14-A10] Trace: SGN-T195646 EST: SGN-E394320 Direction: 3' Facility: INRA
Clone: SGN-C172628 [TUS-14-A10] Trace: SGN-T195646 EST: SGN-E399011 Direction: 3' Facility: INRA
Clone: SGN-C172628 [TUS-14-A10] Trace: SGN-T200444 EST: SGN-E399534 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202233Length: 545 bp (699 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202233 [] (trimmed) GCCAAGTGTATCCAAGTTACAATGGCATCCATTTACTATTGTTTCAAGCAGTAATTTGGAGACAGATAAATTAAGTGGTGTAATTAAATGCATGG
GAAGTTGGAGCCAAAAATTAGAAAAACAACTTTCTTCTTCTCCAGATCACCTACAAATATCAACAGAGGGACCTTATGGACCTTCATCGTGTTAT
TTCTTAAGTCGAGAATGCTTGGTGATGATTAGTGGAGGAAGTGGAATTACTCCCATGATTTCAATATTTCGAGAGCTCATTTACAGAAGCACACT
TTAACCAAACACCAAATTACCAAAAGTCATCTTAATTACATCCTTCAAAAACACATCAGATCTCACAATGCTTGATCTCTTGCTCCCTATCACCA
CAGCTCCTTTCGATATCTCCAACTTAGAATGCAAAATCGAAGCTTATATCACTAGAGAAAACGAACCACAACAACACGAGTCGAAACAACAACTC
CTAGTGTTCAAACAAAATCCGAAAGACTCTCCTATTTCTGCAGCACTCGGGAAAAGCAGCTGGCTTTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202233] SGN-U582231 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23894 [Download][View] Facility Assigned ID: TCAAU02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5