Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E202281

Search information 
Request: 202281Match: SGN-E202281
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C11014Clone name: cLEC-6-O21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172832 is on microarray TOM1: SGN-S1-1-3.1.20.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T195242 EST: SGN-E393916 Direction: 3' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T195392 EST: SGN-E394066 Direction: 5' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T195684 EST: SGN-E394358 Direction: 5' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T195684 EST: SGN-E399544 Direction: 5' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T199554 EST: SGN-E398228 Direction: 3' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T199554 EST: SGN-E399071 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202281Length: 576 bp (828 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202281 [] (trimmed) CTGGAAAGGTTCTTGCTACTGTGGTCCGGGTTGGAGAAGAGGGAATATATTTTGACACAAGGGGAAAGAAATTTGTCATTGGTATGGAGCCCCAA
ACTTCTGATAATTATCTACTTAATGGCTTAAATGGTACCAAATTAAGTGGTATTGAACTGGAAAGTCCAGATGCTGGACAGTTGACTGTGGGAGA
TCTTCTGCCGAAGCAGCAATTGTATGTGGAATGTGAAGAAGAAGACGAAGTTATTGTTTTTAAGCCATCAGTGATAGAAAAATCTAATGACATCT
CTTCAAGTGCTATGACCTCAGCGGTTCCTGTAGCTGGTATTAGTGTTGTCAATGCTTCTTCTGGTGCTAGCATGGAGTGTGTTGATTCGTGTTGT
GAGATGGGGCCATTTCCATCTGCACTCGATGGATTGAGGTTGCAGAATGGTTGGAGTACTACAAGGCTGCCAACAAGCATTTCTCTTACTAATAC
CCAATATATGCAGGCAATCCAACCAAGTACTTCAATGTGGTCTGTAGAGCAAGGTGCTTTTATGAATGGATTGGGTGGCTTGAGCTTGACAGGAA
ATGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202281] SGN-U567903 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23942 [Download][View] Facility Assigned ID: TCAAU95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5