EST details — SGN-E202309

Search information 
Request: 202309Match: SGN-E202309
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10917Clone name: cLEC-6-K14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172768 is on microarray TOM1: SGN-S1-1-3.3.20.2
See unigene SGN-U578195 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195230 EST: SGN-E393904 Direction: 3' Facility: INRA
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195377 EST: SGN-E394051 Direction: 3' Facility: INRA
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195378 EST: SGN-E394052 Direction: 5' Facility: INRA
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195378 EST: SGN-E399541 Direction: 5' Facility: INRA
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195379 EST: SGN-E394053 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202309Length: 582 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202309 [] (trimmed) GATGGATTGGGGAAACTGACAGTGAATCTGCTGACCTGCAGAAGGGATGGGCATCTGTACAGAGTATTCCAAGGACAGTGCTTTACGACAAGAAG
ACAGGGACACATCTACTTCAGTGGCCAGTGGAAGAAATTGAAAGCTTAAGAGTGGGTGATCCTACTGTTAAGCAAGTCGATCTTCAACCAGGCTC
AATTGAGCTACTCCGTGTTGACTCAGCTGCAGAGTTGGATATAGAAGCCTCATTTGAAGTGGACAAAGTCGCGCTTCAGGGAATAATTGAAGCAG
ATCATGTAGGTTTCAGTTGCTCTACTAGTGGAGGTGCTGCTAGCAGAGGCATTTTGGGACCATTTGGTGTCATAGTAATTGCTGATCAAACGCTA
TCTGAGCTAACGCCAGTTTACTTTTACATTTCTAAAGGAGCTGATGGTCGTGCAGAGACTCACTTCTGTGCTGATCAAACTAGATCCTCTGAGGC
TCCGGGAGTTGGTAAACAAGTTTATGGTAGTTCAGTACCTGTGTTGGACGGTGAAAAACATTCAATGAGATTATTGGTGGATCACTCAATTGTGG
AGAGCTTTGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202309] SGN-U578195 Tomato 200607 Build 2 342 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23970 [Download][View] Facility Assigned ID: TCAAV67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5