EST details — SGN-E202317

Search information 
Request: 202317Match: SGN-E202317
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C11006Clone name: cLEC-6-O12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172825 is on microarray TOM1: SGN-S1-1-2.1.20.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195127 EST: SGN-E393801 Direction: 3' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195313 EST: SGN-E393987 Direction: 5' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195750 EST: SGN-E394424 Direction: 3' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195750 EST: SGN-E398948 Direction: 3' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T199585 EST: SGN-E398259 Direction: 5' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T199585 EST: SGN-E398949 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202317Length: 650 bp (815 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202317 [] (trimmed) CCCGCCTCTCTCTCTTTCCCTCATCTCTTCTCCCCTCGCCCCGCTTTCCTCTTCTCCTCCTCCGAACGGATCACCGGCGAGCAGCAGCCCCGGCG
ACTCCTCTCTCTCCCTCTCGTCTTCCTCTTCTCCTCTTCCCTAGACCCCTCTCTCTTTTCCCATCCTCTCTTCTTTCAGCGAACTCCAGGCTGCC
AGCAGCTCCAACCAGCGACAGCAAGCCTGCAGCTCGGCTAGAGGGCGATAGCAACAACACCAACTGCTCAAGCTGAGGCTCAAAATCCTGTGATT
TCGTACCAAACGGATCTCCTCAGATCCGTCCAGTTTCATAATCTCAGGGAAGAGTCCATATATCTTGTTGTAGTTACAACATGGGGATTGGCCAT
GGTGTTGACTCCCTCATTGTTGTATTGCTGCTGAGTTCAATGGTTTCCACTTGTGTTGCTTACCGCCCCGGTGACATCGTTCCAATGAGCAAAAT
GGGTCAATACCACTCTTCGAGGACTGTTTGGCATGATATGATTGGAAAACATTGTCCCATTTTCGGGGTTAATCGGGAGGTGTTGATACCGATTC
CAAAACCAACTGGTTTTACTGGAGCTGATCCTTACAAGATATCATTCCAAGTTGGAAGAGAAAAATATCACGTGCCATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202317] SGN-U584740 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23978 [Download][View] Facility Assigned ID: TCAAV90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5