EST details — SGN-C20232

Search information 
Request: 20232Match: SGN-C20232
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20232Clone name: cLED-29-M14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184350 is on microarray TOM1: SGN-S1-1-5.1.16.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184350 [TUS-44-I20] Trace: SGN-T198186 EST: SGN-E396860 Direction: 3' Facility: INRA
Clone: SGN-C184350 [TUS-44-I20] Trace: SGN-T198187 EST: SGN-E396861 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239814Length: 243 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239814 [] (trimmed) GTGTTTATTTTTGTTATGTCTGTGTTTGTTTCCCATTGAGGTGTTTTCATCAAGTTTCACTTCCCAAAAGCCCATTGAATTACCGAGTGCTTCTC
CTAAACCTAATCCAGTACTTGACACAAATGGTAACGAACTTAATCCTAATTCGAGCTATCGCATTATTTCCACATTTTGGGGTGCGCCAGGCGGC
GATGTATACCTAGGTAAATCTCCAAGATCATCGGCCCCTTGACTAGATGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239814] SGN-U577283 Tomato 200607 Build 2 78 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56102 [Download][View] Facility Assigned ID: TOVEJ79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0339 Quality Trim Threshold: 14.5