Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E202346

Search information 
Request: 202346Match: SGN-E202346
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10942Clone name: cLEC-6-L15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172785 is on microarray TOM1: SGN-S1-1-2.3.20.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T195123 EST: SGN-E393797 Direction: 3' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T195124 EST: SGN-E393798 Direction: 5' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T195124 EST: SGN-E398943 Direction: 5' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T199541 EST: SGN-E398215 Direction: 5' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T199611 EST: SGN-E398285 Direction: 3' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T199611 EST: SGN-E398942 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202346Length: 530 bp (725 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202346 [] (trimmed) TTTTTTTCTTCTGCCAATAATTACAGGTTTCGATTCAAATTAATCCATAAATTTTGGATACCACATGCTTTGTATAAAGAAAAGAATAAAAACTT
AGGATACACATGCATTTCTATAGAAAATTAGGATTTTGTCATTGACTTCATATTTTTTTTGTTGTCAACATCGATTTGTTTTTTTAATCTTGATG
TCAGAAAGTGCAAGCAAAGTTTTGATTAAACGGTCATGTAAAGATATGCTCTTAAGATTATTTAAATGGTTAGATGTGCAGTCTGTCCTCTCATA
GCTTTTCTAGTATTTGTGATCACAAAATCTCACAAAATCATCCAAAGAAAGCTTTTTCTACTCTATCAAAGGGAGAAACACAAACAAAAAATAAA
AGATAGGGGTGACTTGATCTTAGAGAACATATATAGTGCAAAATGGCAAGAAAATTGAGTACTTTAGTTGTTTTTGGTGCAATTTTATTTGCTTT
AATACAACATGTTTCAATGGCACAACAAACTCATGTTGTTGGTGATANCTTTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202346] SGN-U580960 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24007 [Download][View] Facility Assigned ID: TCAAW68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0004 Quality Trim Threshold: 14.5