EST details — SGN-E202551

Search information 
Request: 202551Match: SGN-E202551
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10803Clone name: cLEC-6-F12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172686 is on microarray TOM1: SGN-S1-1-5.3.20.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195657 EST: SGN-E394331 Direction: 3' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195657 EST: SGN-E399031 Direction: 3' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195658 EST: SGN-E394332 Direction: 5' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195658 EST: SGN-E399032 Direction: 5' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T199451 EST: SGN-E398125 Direction: 3' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T199550 EST: SGN-E398224 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202551Length: 573 bp (749 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202551 [] (trimmed) AGTATTTGTAATTGCTAGGCTAAAGAACTATAATTTTCCTTAGAAGCAAATCCATATTCCCCTTTACTTCTATATCAAGTGTTCGTATCACAATC
CGGATCTTGTCTAACGGAGCTCTCCGTCTTCTCTCTCTTCTTCGATTTCTGTATAACAAGAGCAATTCACATTTGCATGTGAATCGATTTTCATC
AGATCCACTGCTACATATCTGTTGTTTCATCAGATTTCAAGGTGATCCCGGTTGCTTAAATTATCATACTCATTCTCTGCTTCCGTTCATCTATG
TTTGGGAGTCTTGTGGATGCTCCTGTTAACAGTCCACATCTACGAAGGTCTGGAAGTCGAGCGGTTGTTTCTGATATTGGTACGGTTGAGCTTGG
AGGGAGTCCTGTAGAAGCCCTATTGCACAGCATAGAGGTCAATGAAATGAAGGGTGTAACTGCACCTTTGAGCACCGCGGCCATAATGCCATCTC
CTGTTCTTTTGTGGAGATTTAAGGTACTTCTGTTCCTCATTTGGGGTGTCAGTTGTTGCAAGATCAGCTGGGATTCAGTCATGAGAATGAGCGCA
AAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202551] SGN-U582246 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24212 [Download][View] Facility Assigned ID: TCAAX30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5