Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E203065

Search information 
Request: 203065Match: SGN-E203065
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339Clone name: cLEB-3-B11
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C339 [cLEB-3-B11] Trace: SGN-T22810 EST: SGN-E203064 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203065Length: 459 bp (587 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203065 [] (trimmed) AAACAAATCAAAATCTAGTGTTTAAAGAGAAGAAATCAACACACATAGCATATATAGAATGATATCAATAGTAATAGCAACGTTACAAATTGGGC
TATCAAACTTTAATTAATAACCCTACAATTAACACGGATTTCGCCATTTGTTCCAGTTGGTGGTGGTAAGCTTCCCATTTTGAGCATAGAGTTTT
TGAAATCCTCAAGAAACAAAGATGGATCGTCTACATAATTCTGCACAATTTCTCTAGTGTTATCGTCATCTCCAGTTGCTAGGACTTGGTCAGAA
ACAAGCAAACCTTTTCCTGATAGAAGATTAACATAGTAGTGATTATCGAACGTTGATGGAGTCATATCATCAAGATTTGCTAGTGTAGTGTTATT
GTTAGCTGAGCACAGTTGTTGCAGTGACTGCAAGAAATCCAAGTTCATTTCTGAATTTCTAACACCCGCGTTGTTGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203065] SGN-U598889 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22811 [Download][View] Facility Assigned ID: TSHAK06TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5