Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E203101

Search information 
Request: 203101Match: SGN-E203101
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469Clone name: cLEB-3-J17
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: Alias clone SGN-C183528 is on microarray TOM1: SGN-S1-1-3.3.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469 [cLEB-3-J17] Trace: SGN-T22848 EST: SGN-E203102 Direction: 3' Facility: TIGR
Clone: SGN-C183528 [TUS-42-G14] Trace: SGN-T195034 EST: SGN-E393708 Direction: 5' Facility: INRA
Clone: SGN-C183528 [TUS-42-G14] Trace: SGN-T196025 EST: SGN-E394699 Direction: 5' Facility: INRA
Clone: SGN-C183528 [TUS-42-G14] Trace: SGN-T196025 EST: SGN-E399264 Direction: 5' Facility: INRA
Clone: SGN-C183528 [TUS-42-G14] Trace: SGN-T196135 EST: SGN-E394809 Direction: 3' Facility: INRA
Clone: SGN-C183528 [TUS-42-G14] Trace: SGN-T200298 EST: SGN-E399263 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203101Length: 374 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203101 [] (trimmed) GAACATCCAATTAAGGCTTTTGGATGGGCAGCTAGAGATACTTCTGGTGTTCTTACTCCTTTCAACTTTTCAAGAAGGGCTACTGGGGAGAAAGA
TGTGCAATTCAAGATCTTGTATTGTGGAGTTTGCCACACAGATCTTCACTTTCTCAAGAATGAATGGGGAGTCACCAGATATCCTGTTGTACCAG
GGCATGAGATTGTGGGTGTGGTGACAGAAGTTGGTAACAAAGTTGGTAAATTTAAAATTGGTGACAAAGTTGGTGTTGGATGTCTAGTAGGATCA
TGTAAAAAATGTGACAATTGTTCAAATGATCTTGAAAATTATTGTCCTCAACAAATACAAGCATATGGTCAAATGTACATCGACGGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203101] SGN-U578510 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22847 [Download][View] Facility Assigned ID: TSHAK57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5