Notice: Due to a server restart, the site was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E203159

Search information 
Request: 203159Match: SGN-E203159
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C408Clone name: cLEB-3-F2
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C408 [cLEB-3-F2] Trace: SGN-T22904 EST: SGN-E203158 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203159Length: 449 bp (616 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203159 [] (trimmed) GTAACACATTTTTACTTGCGTCGCAATTTCATAGAACATTGGTTTCATCTTACCACTATATCCGCGCTTGGATCGCCACCCTAAACTTTCAATCT
GATACTAACATAGGGTTTATTTCATGTTTTACATGCCTGTGACTCCTTATGTACAAGTTTAAGTCACTTTAGGAGGAACTACAGGAGCTAGCTGA
ACAATGAGCATTTCACCTTTCTATGGGTTTTCCTTTCTGCAAATCGACGTTGTCTTCGTTCATAGATAGTCCTGAGAAGTGAGACTTCAAGCCAA
TCCAGCATTGGTAATAATCGTGATCCATAAACGGAGATTCAAGAGCCCACGGACAGACTCGGGGTACTAGGCAAGACTCAAACATGAAAGCCATG
GTATCAGCTATTCTATGTGGACCAGCTTCATTTCCAAGTGCAATGGTTGCCTCAAAATGTTTTGGTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203159] SGN-U566282 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22905 [Download][View] Facility Assigned ID: TSHAL25TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5