EST details — SGN-E204186

Search information 
Request: 204186Match: SGN-E204186
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1596Clone name: cLEC-13-E6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C180948 is on microarray TOM1: SGN-S1-1-7.4.17.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180948 [TUS-35-L2] Trace: SGN-T193702 EST: SGN-E392376 Direction: 5' Facility: INRA
Clone: SGN-C180948 [TUS-35-L2] Trace: SGN-T193951 EST: SGN-E392625 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204186Length: 293 bp (976 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204186 [] (trimmed) GACATCCCTCTTCCTTTTGTGGCTATTCTTGAAAAAAAAAATCTTTAATCTATGGCTACTCTCACAAATTTTTTGCTCAAACCCTCTCCAAATCT
AGCTTCAATTACAAAAATTAGCCCTTCACTTTACTCCAATTTCCCTTTTGAGAAATCCAAACAATCAATTTTCAAGAACCTCAAAACAAACAAGC
CCTTATTGATTACAAAGGCAACAGCAGCACCTGATGTTGAGAAAAAAGTGGCTAAAAGTGAAAGAGTACAAAAGGTTAATAGTATGGAGGAATTG
GATGAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204186] SGN-U580753 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25939 [Download][View] Facility Assigned ID: TCABX27THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5