EST details — SGN-E204299

Search information 
Request: 204299Match: SGN-E204299
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1811Clone name: cLEC-13-P22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173190 is on microarray TOM1: SGN-S1-1-5.4.19.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173190 [TUS-15-H20] Trace: SGN-T189010 EST: SGN-E375396 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204299Length: 542 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204299 [] (trimmed) CCCTAATGCCCCTGTTGTCAAGCTTCTCTTATTAAGTTCACCTTATTTCAGCAAGATTTATTCTCTCTCTAGAAACAGACCCATCAATGGAAACC
TTACCAAAACCTCAAGAATTTCACAGCCCATGTCTAATTTCATCACCAGATAGCCATAGCTCCAACAGTTCAAGCTGTAGCAATAGCAGCAATTC
TAACCACCACCACAACAATGGTCTTCACCAACATCACCGCCGCTACCCAACACCACCCACTACCCCAACGCCTACTACACCACAACCACTACCAC
CACAACTACCCATCACCAGATCCGAACCGAACAACCCATACCCGACTACCTTCGTTCAAGCTGACGCTTCGTCTTTCAAACAGGTAGTTCAAATG
CTTACTGGGTCCTCTGAAACCGCCAAGGTTGGTGCTAATTCGGGCCGGACCGAGCCCGTTAGGAATCCGATCCCTCCAATTAAAACTGGAACTAA
GAAGGAGAAATCAAGTTCAAAGCTGTATGAGAGAAGGAACAGCATGAAGAATTTCAAAATTAGCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204299] SGN-U571303 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26052 [Download][View] Facility Assigned ID: TCABZ95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5