Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E204354

Search information 
Request: 204354Match: SGN-E204354
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1671Clone name: cLEC-13-I14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173132 is on microarray TOM1: SGN-S1-1-7.2.20.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173132 [TUS-15-F10] Trace: SGN-T188928 EST: SGN-E375314 Direction: 3' Facility: INRA
Clone: SGN-C173132 [TUS-15-F10] Trace: SGN-T188929 EST: SGN-E375315 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204354Length: 186 bp (1011 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204354 [] (trimmed) GTCAATTTCAAAATAAAACTTCTCAGGCTATACTCTTAGACTTCATCGATCGATAATGGCTCTAGAAGCTATAACGCAACAACAACAATATCTTT
ATGCTTTACTCGGAACTACAAATTGGAGTATTGATTCTGGCTCTGATTATTACAACAATAATGAATTTGTTCCGAATCATCAAAATGTAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204354] SGN-U581766 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26107 [Download][View] Facility Assigned ID: TCABX55THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5