EST details — SGN-E204683

Search information 
Request: 204683Match: SGN-E204683
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1967Clone name: cLEC-14-H1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181000 is on microarray TOM1: SGN-S1-1-3.2.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181000 [TUS-35-N6] Trace: SGN-T193710 EST: SGN-E392384 Direction: 5' Facility: INRA
Clone: SGN-C181000 [TUS-35-N6] Trace: SGN-T193959 EST: SGN-E392633 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204683Length: 566 bp (909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204683 [] (trimmed) ATTTTCACAAAGTCATGGCTACTTCCTCTCAACCATTGTTAGATTCTCCCAAAACAAAATCCTCCTCTTCTACTAAAGCTCTCTATGTGCTTCTC
TCCTTAGCTGCTATTGTGGGCTCAGTTGGATTCATTTCAATCTGGGCCATCAATCGTACATCAATTTCCTTGACAACTCGTGTTTGTGATACGGC
CCATGATCAGCCATCTTGCTTAGCCATGCTGTCTGAGGTTGCACCTGCTGGTCTGATGGATATAAAAACAGTTGATTTGCTACAGATGGTTTTGC
ATAAATCATCGTTAAAAATCCACGAGACGATCCACTTGGCAAGCAATGTGAATGGTCGGATCAATAATGGCCAGGAACAAGTAGCTCTAGAAGAT
TGTTTAGAGTTGATGGATTTGTCAAGGGATAGATTAATGGACTCCATGGTGGGACTTGGGAACCTAACGGTCCAAGCCCATTTTGATGTTCATTC
ATGGCTAAGTAGCATTCTCACCAACCATGTTACTTGCATAGATGGCCTAAATGGCCAGGTCCGGTCTATTATGGAGCCTATGTTGAATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204683] SGN-U585823 Tomato 200607 Build 2 134 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26299 [Download][View] Facility Assigned ID: TCACC37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5