EST details — SGN-E204689

Search information 
Request: 204689Match: SGN-E204689
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1981Clone name: cLEC-14-H23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173287 is on microarray TOM1: SGN-S1-1-4.4.19.2
See unigene SGN-U572209 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C173287 [TUS-15-L21] Trace: SGN-T188887 EST: SGN-E374657 Direction: 3' Facility: INRA
Clone: SGN-C173287 [TUS-15-L21] Trace: SGN-T188888 EST: SGN-E374658 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204689Length: 489 bp (927 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204689 [] (trimmed) TTGTAACCTTAAAGGATACTTATGAGGATGATAATGCAGTGCATATAGTTATGGAGCTGTGTGAGGGTGGTGAGCTATTTGATCGGATCGTTGCA
AGGGGGCATTATACCGAGAGGGCAGCAGCTGCGGTGACTCGCACAATTGTTGAAGTGATTCAGATGTGCCATAAGCATGGAGTTATGCATCGGGA
CCTCAAGCCTGAAAATTTCTTGTTTGAAAACAAGAAAGAGACAGCACCATTGAAGGCAATTGATTTTGGTCTCTCAGTATTCTTTAAGCCTGGTG
AGAGATTTAACGAAATTGTGGGAAGTCCGTACTACATGGCGCCCGAGGTGCTGAAGAGAGACTATGGTCCAGAAGTAGATGTCTGGAGTGCTGGA
GTAATTCTCTACATCTTGCTATGTGGTGTGCCACCATTTTGGGCAGAAACTGAACAAAGAGTTGCACAAGCAATCATTCGTTCTGTTGTGAATTT
TAAAAGGGACCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204689] SGN-U572209 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26305 [Download][View] Facility Assigned ID: TCACC48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5