EST details — SGN-E204806

Search information 
Request: 204806Match: SGN-E204806
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1867Clone name: cLEC-14-C18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173214 is on microarray TOM1: SGN-S1-1-5.1.19.2
See unigene SGN-U577319 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C173214 [TUS-15-I20] Trace: SGN-T188661 EST: SGN-E375807 Direction: 3' Facility: INRA
Clone: SGN-C173214 [TUS-15-I20] Trace: SGN-T188662 EST: SGN-E375808 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204806Length: 361 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204806 [] (trimmed) TGGCACCAATGCAGTTCTGGATGGTTTTGCGGAAGAAATATCCTCAATTTGGCCAGCAGAGCAATGGAGCTTTCATGCAACAGGATGCCGAAGAG
TGTTGGACCCAACTACTTTACACCCTTTCCCAGTCTCTTAAATCACCGAATTCGAGTGAAGGTCAGGATATTGTGAAGACTCTCTTCGGTATTGA
CTTTGATAACAGGATCCATTGTGCTGAAAGTGGTGAAGAAAGCACAGAAACAGAAACTGTCTATTCCCTTAAATGCCACATTTCGCAGGAAGTTA
ACCATTTGCACGAGGGTTTGAAACGTGGTCTGAAATCGGAACTGGAGAAGGCATCTCCTTCACTTGGACGCAGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204806] SGN-U577319 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26422 [Download][View] Facility Assigned ID: TCACB21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5