EST details — SGN-E204911

Search information 
Request: 204911Match: SGN-E204911
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2116Clone name: cLEC-14-N4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173355 is on microarray TOM1: SGN-S1-1-8.3.19.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173355 [TUS-15-O17] Trace: SGN-T188535 EST: SGN-E374891 Direction: 3' Facility: INRA
Clone: SGN-C173355 [TUS-15-O17] Trace: SGN-T188536 EST: SGN-E374892 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204911Length: 354 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204911 [] (trimmed) TCAGGAGCACTGCTCTGTCAACTATACAAATGTCATCACGGTTGTTTTACTCGAAGTCGATGAATATAACAAGACATTAAGAAAAAAATACAGAC
TGGACAAAACTCGATCACTATAAACGGAGTCTATATTGCTGATGCTGCTTCAGTGAAATATATAGATGTTGTCAAAACTCAACAGTGGAAAGATC
GAAATAAGTAGAGCGAGCGAGCATATCTCCTGAGAACTGTTAACCAACATTCTACTCGGCTTACAGCAAGCCAGCTATCTTCAGAGCATTTTCGA
AATCTTCTTCATTACTCCATGAGGGAATCTCAGCCACTTGATGGTTGAAATGGTTCTCAATCTTTGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204911] SGN-U586037 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26527 [Download][View] Facility Assigned ID: TCACD74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0