EST details — SGN-E204946

Search information 
Request: 204946Match: SGN-E204946
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2633Clone name: cLEC-16-K15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173463 is on microarray TOM1: SGN-S1-1-4.4.18.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173463 [TUS-16-D5] Trace: SGN-T1278 EST: SGN-E378662 Direction: 5' Facility: Giov. Lab
Clone: SGN-C173463 [TUS-16-D5] Trace: SGN-T196780 EST: SGN-E395454 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204946Length: 452 bp (816 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204946 [] (trimmed) GTCAACAACTGGCAACTCAGTCTCTTCTTGGGTTACCCCCACTTCCCCCTAGTTTGCTCCCCCAGGCACAGCCTCAGACTCAACTAGCACTATCG
CAAAACCAAGTTTTGCAAAGTCAGCCTAACCCTTCTAGAAATCCTTCCGTCAATGCAACCCAAGTCAATGTGTCAATTAATCCGCCAGTTCAGGT
GGGAACTTCTGTTGCTGTAAAGCAGCAAATGCAGCCTTTTTTCTTACAACAAGCTGGGCCAGTTGCTTCCATGAATTTTACATATAATAGTCAGC
TGGGGACAGAAAAGACAAGCTATCCTCCTCCTCCTTCATCAATGCGTACCCCGTCATTGGAACAAGGTTCTCAGGGAAATCCTTCAGTAGTTTCT
GGTGTCTTGGATAATACGAATAAAGACTCTCGACGACCCCAGGCTCCTAATAATTCATCTTTGATTGCCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204946] SGN-U582161 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26835 [Download][View] Facility Assigned ID: TCACI68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5