EST details — SGN-E205092

Search information 
Request: 205092Match: SGN-E205092
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2513Clone name: cLEC-16-E21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173417 is on microarray TOM1: SGN-S1-1-2.2.18.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173417 [TUS-16-B7] Trace: SGN-T196662 EST: SGN-E395336 Direction: 3' Facility: INRA
Clone: SGN-C173417 [TUS-16-B7] Trace: SGN-T196663 EST: SGN-E395337 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205092Length: 364 bp (831 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205092 [] (trimmed) GCTTGTACTTCTAATGTCTCCTATCTTTGATGTAGTAAGTATGGACCCATACAGTCCGTAACTTATCCTATCTCTTAGCCAAATCCCACAGATAG
TTGAGTATTACTTCTTTGTTCCACACATACACATCTGTAATATCCAGGCCTCCAACAACTTTTGGTTAACAAATTGTATCCCATGCTACAAGAGC
TTTCCCTTTAGTTTGTGTATCACCATTCCATAGGAATCTCTTGCATATCGCTTCTACCTACTGCAACACTTTTTGGGGAGTAAGAATATTTGCGC
CCAGAATGCTTGAATGGAAGTTAGCAAAGTTTGTGCCAGATAAAGCCTCTCTGCATAAGATAGAAATTTCGTAGTCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205092] SGN-U584757 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26981 [Download][View] Facility Assigned ID: TCACI35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5