EST details — SGN-E205186

Search information 
Request: 205186Match: SGN-E205186
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2730Clone name: cLEC-16-P15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173500 is on microarray TOM1: SGN-S1-1-7.1.18.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173500 [TUS-16-E18] Trace: SGN-T196722 EST: SGN-E395396 Direction: 3' Facility: INRA
Clone: SGN-C173500 [TUS-16-E18] Trace: SGN-T196723 EST: SGN-E395397 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205186Length: 465 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205186 [] (trimmed) GGTTACAAAAAAAAATGAAAAATCAATTTCAAGAATTAAACTTTAGGGAATTTATGGATGTGTTAACAAAGCAAGAACAATATTTTTTTGAGAAA
AAAGCAGCTGAGAATAAAAATGAGAAATCATATGTTAATGAAATTTTTGGTGAGCTTTATTTTGAAGAAAATAATGGCGAGTCATCCATAGAACA
CATTTTTCCTCCAATGCCAAAAAAAAATTCTAGTGAAAATAATGCTAATAAAGGTATTATTTCCTCTCTTTTTTATTTCTCGTATGTTTGATACG
ATTAAAGTCATTTTTTAAGAAAAATCTTTTTTAGGAATTTTTTTGAATTTTCAAACTTTTTGAAAAACTCTTTTTGATGGAAACGATCTAGCTCT
ACTGTATCCCGAAAAGATAGAAGTAATATATGTGTATATTTTCTCTAGAATATCAGATCTCATGATATCTCACTTATAGGATTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205186] SGN-U577049 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27075 [Download][View] Facility Assigned ID: TCACK92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.880 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5