Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E206293

Search information 
Request: 206293Match: SGN-E206293
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4126Clone name: cLEC-23-K11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183799 is on microarray TOM1: SGN-S1-1-4.2.18.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183799 [TUS-43-B21] Trace: SGN-T197930 EST: SGN-E396604 Direction: 3' Facility: INRA
Clone: SGN-C183799 [TUS-43-B21] Trace: SGN-T197931 EST: SGN-E396605 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206293Length: 607 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206293 [] (trimmed) CCTCTCCCTCCATCTTCCGTACCCACCGTCAACTCTACCGGCAGCACCAGGGCTGCTACAAATACTACGACGACCACCACTGCTTCTACTACCAC
TATCTCCATTTCGGAACTTGAAAAGCTTAAGGTTCTCGGTCATGGAAACGGTGGAACTGTGTATAAAGTCCGTCATAAGCGGACCTCCGCGATCT
ACGCTCTGAAAGTTGTTCACGGTGATAGTGACCCAGAGATTCGCCGTCAGATCCTCCGGGAAATCTCAATTCTTCGCCGGACGGAATCTCCTTAC
GTTATCAAGTGTCATGGAGTTATTGATATGCCCGGCGGGGATATCGGTATTCTTATGGAGTATATGAACGCCGGTACATTAGAAAATCTACTTAA
ATCACAATTAACTTTCTCCGAACTCTGTTTAGCGAGAATCGCTAAGCAAGTGCTTGGTGGATTAGACTATTTGCATAGTCACAAAATCATTCACA
GAGATCTAAAACCTTCGAACCTTTTAGTGAATCGTGAGATGGAGGTGAAAATCGCTGATTTCGGAGTGAGCAAAATCATGGGAAGGACTTTGGAT
CCTTGCAATTCATACGTTGGAACTTGTGCGTATTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206293] SGN-U564043 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28252 [Download][View] Facility Assigned ID: TCADK66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5