EST details — SGN-C20670

Search information 
Request: 20670Match: SGN-C20670
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20670Clone name: cLED-30-E12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C186213 is on microarray TOM1: SGN-S1-1-6.3.5.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242640Length: 315 bp (878 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E242640 [] (trimmed) ACTTCTGTTTGTTTATCCAGGCAGAAAAGTCCTATCGTTTATGATTCTCACGAGCAATGAGGCTATGTTGTCAAGCTCCAGTTTTCTGGGAAGAC
CTATTGGGTCTCTGAGGCAAGGTCTAGTCTCTGGCAGCCGTGAGACTTTCACCATGGGAAATGACTCTGACCCTACACATTCTCGCACGCCTGAG
GCAAGTCCAGCAACTATGCACAAAATATCAGGTGGACATAGAAGCTCTCTACTTGGTGGATCATCTGATCCTAGGTATGCCTCATCTAGCAAGAA
TACTTCTGGGATAAAGAACTATGAATCGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242640] SGN-U566821 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56570 [Download][View] Facility Assigned ID: TOVEN30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0029 Quality Trim Threshold: 20.5