Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E207587

Search information 
Request: 207587Match: SGN-E207587
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5709Clone name: cLEC-32-M1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173855 is on microarray TOM1: SGN-S1-1-4.4.17.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173855 [TUS-17-D13] Trace: SGN-T189051 EST: SGN-E376437 Direction: 3' Facility: INRA
Clone: SGN-C173855 [TUS-17-D13] Trace: SGN-T189052 EST: SGN-E376438 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207587Length: 369 bp (720 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207587 [] (trimmed) GGGAGAGTCATTCCCTACCGCCGTTTACTTATCTCTTATCCCCATCATCGGTGGGTGTGGTCTTTCTGCGCTTACAGAGTTGAACTTCAACTGGA
TTGGTTTCTCGGGTGCTATGATCTCGAATGTGGCATTTGTCTTCAGAAATATATTCTCCAACAAGGGTATGAAGGGGAAGTCTGTTAATGGGATG
AACTACTATGCTTGCTTGTCTATGCTGTCTTTGTTGATTCTCACACCATTTGCCATTGCTGTTGAGGGACCACAAATGTGGGCTCTAGGATTTGA
AAAGGCTGTCTCTCAAATCGGTCCCCAGATCGTCTGGAGGATGGCGGCCCACAGTGTATTTTATCACCTCTTCCATCAAGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207587] SGN-U581521 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29800 [Download][View] Facility Assigned ID: TCAEU73THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0225 Quality Trim Threshold: 14.5