Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E207811

Search information 
Request: 207811Match: SGN-E207811
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5696Clone name: cLEC-32-L17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173850 is on microarray TOM1: SGN-S1-1-1.4.18.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173850 [TUS-17-D8] Trace: SGN-T197064 EST: SGN-E395738 Direction: 5' Facility: INRA
Clone: SGN-C173850 [TUS-17-D8] Trace: SGN-T199825 EST: SGN-E398499 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207811Length: 485 bp (737 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207811 [] (trimmed) GTTATATTATATGTAGTGCCAAATATTTACAAAGTTATGACAGCTATATATATTTTTTAGACACACTACATTCCATTCAACTTTTATGTATATAG
TTAAATAATACTAGTCCATACCACCTAACAATCATGCCAAATTTGCGATCTAGAGTCGGTAAATTTAGAATAAATATATATATTTAAAAATCAAA
ATCAATAATTTTTGCGGTTTTTTAATGTAACAATTTTTTTTTAATGTAGTATTTAACTTTAGAAGTGGATCACACAGTGTGGCTGAAGTATCAAA
AGGGGCTTTTGATTCATGCAATACTTCAAGCCCAATTTCAATTTCAACAAATGGCCCAACAAATATTACATTGAGTTCTGCTGGATCACATTACT
ATCTTTGTACTTTTCCAAGCCATTGTACATTGGGCCAGAAATTGGCTATCAACGTCTCCGGCTCCGCCTCTCCCGCTCCTCAGCCAGCCCCCGCC
ACTCCACCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207811] SGN-U578433 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30024 [Download][View] Facility Assigned ID: TCAEW69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5