EST details — SGN-E207856

Search information 
Request: 207856Match: SGN-E207856
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5766Clone name: cLEC-32-P22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173870 is on microarray TOM1: SGN-S1-1-5.1.18.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173870 [TUS-17-E4] Trace: SGN-T196972 EST: SGN-E395646 Direction: 3' Facility: INRA
Clone: SGN-C173870 [TUS-17-E4] Trace: SGN-T196973 EST: SGN-E395647 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207856Length: 544 bp (791 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207856 [] (trimmed) ATCTAAATTGCCATAAATATTTAATCCCAATCGATGCAGATCACTTTCTACCATAATAAGTTCTACTTGCACTAGTTCTGATCAATAGTGACACA
ATCTGTAATTACACAATCTATTTCATCCATGAAGTTTTTTCATTTCCATAATCTGGAAATTGCAAGGATACACTTCTGGATATGCAGCACATTTT
CAAAAAGTACCATTTTAATGTGGATATCTATATGCTTCCACATCATGCATGTGGCTCGCTAACTCGTTTGGGATAGGCCCAGAGCTTGAAGAGAG
AGCCATCAACTGAGTCATCTGAATCACTATCACTATCCGAGGAAGGTATGGACTCCTCTATTACATAATCAACAATCTGTTCAAGTGACACAGGC
ATGATCTGATGTTCATCAGAAATCTCCCCATTAGAACACTTGGAATTATTCAACCAAACAATTGAATTGCACTGCTTGCAAAAGCCCCTCTGGGA
TGTTACCTTTTTTGAAATTCCTCTATAAGCTCGCTTGAAAGCATCTTTCCAGTCAACATTATCTGCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207856] SGN-U586311 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30069 [Download][View] Facility Assigned ID: TCAEX95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5