EST details — SGN-E208020

Search information 
Request: 208020Match: SGN-E208020
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6153Clone name: cLEC-34-I21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181848 is on microarray TOM1: SGN-S1-1-3.1.10.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181848 [TUS-38-A14] Trace: SGN-T194563 EST: SGN-E393237 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208020Length: 419 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208020 [] (trimmed) GGAGATTGGAAAGTAGGAAATTGTTTGAAATTTCACATCCGAATCGGAACATCGGCGGAGCTCCATCGGGCATCCGCAAAGAGCTTCATCGTGGC
TCCCTCAGGGTTACAACAACATCAAACTCTTACTAGAAGGAAATCAGCACCGCCGTCGACATTGAATCAAGCCGGTGCATCGGGCTCGGAGCGAA
TAGTGCTGAAAGAATCCTCATCCGAATCGGACCTTGATCTTTCATTTTGGCAAAGAACCTGGTTCATTGGTCTCTTACTTCTCATGGCGAATTCC
TTCTTCGGCCTAGCGCTGTTTCTTTTTCTCACCCTGGACTCTGATTACATATCAACAACACCTGTCTCCGCTGCTTCCGAAAGCGTTCAGATTAC
ATATGGATCCGCGATTAAATTGATGCACGAGAAGACAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208020] SGN-U585061 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30464 [Download][View] Facility Assigned ID: TCAFC59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0253 Quality Trim Threshold: 14.5