EST details — SGN-E208412

Search information 
Request: 208412Match: SGN-E208412
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7041Clone name: cLEC-37-J5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174120 is on microarray TOM1: SGN-S1-1-3.3.17.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174120 [TUS-17-O14] Trace: SGN-T197042 EST: SGN-E395716 Direction: 3' Facility: INRA
Clone: SGN-C174120 [TUS-17-O14] Trace: SGN-T197043 EST: SGN-E395717 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208412Length: 490 bp (752 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208412 [] (trimmed) GAAAAACTCCATCTCAGCGAAATAGCAACCATGATTTCTCAGTTCTTTGTGCTTTCTCAGAGAGGCGACAGCATCGTCTTCCGCGACTATCGGGG
TGATGTACCAAAAGGAAGTGCAGAGATCTTCTTCCGGAAAGTGAAGTTTTGGAAAGAAGATGGCGGAGAGGAAGCACCTCCTGTATTTAATGTGG
ATGGTGTGAACTACTTCCATGTGAAGGTAGTTGGTCTGCTTTTTGTTGCGACATCTAGGACAAATTGGTCGCCTTCTCTAGTATTGGAGCTTCTC
CAGAGGATTGCACGTGTCATCAAAGATTACCTTGGTGTTCTAAATGAAGACTCATTGCGGAAAAATTTTGTGCTGGTGTATGAGCTTCTTGATGA
AGTTGTTGATTTTGGTTATGTGCAAACAACGTCGACAGAAATCTTAAAGTCTTACATATTTAATGAGCCAATTATGATTGACGCTGGCCGCTTGC
CACCCCTTGGTCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208412] SGN-U585422 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31403 [Download][View] Facility Assigned ID: TCAFQ51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5