EST details — SGN-E208419

Search information 
Request: 208419Match: SGN-E208419
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7076Clone name: cLEC-37-L21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174134 is on microarray TOM1: SGN-S1-1-5.4.17.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174134 [TUS-17-P4] Trace: SGN-T197164 EST: SGN-E395838 Direction: 3' Facility: INRA
Clone: SGN-C174134 [TUS-17-P4] Trace: SGN-T197165 EST: SGN-E395839 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208419Length: 526 bp (675 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208419 [] (trimmed) GTTACCGATAACGCCACGGACAGTAAATACAGCTCCAATGTTTCATCACGATGATCAATTCGGCTCTGTACCCATAACTCCACGGACGGCGTCTG
TAGCACAAACGCCGTCCATGTTATCGTTACCAATAACTCCACGGACGGCTCGAACACCGTCCATAGTATCGTTACCTCCTTCACAGTTTCACTCG
CCGTCTCTATCTCGATCACCGTTACTTTTGACGGGAGATCATGCTACAAATAAACCCGTTAAAACTCCAAGGTCACGTGGATTAACCCCGCGTTT
CATCACTCCTTTGGGTAGTCCTCTTAGAAAGGCCCTTAAAATGACAATATTGGATCCACAAGACGCGTGGTTACCAATCACCGAGTCCAGAAATG
GAAACGCATTCTACGCTGCCTTTCATACTCTTTGTTCTGGGATTGGTATTCAAGCTCTTGTTCTGCCTGTTGCTTTTACCATACTTGGCTGGGCT
TGGGGTATCATTGTCTTAACGGTAGCATTTGTATGGCAGCTCTACACTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208419] SGN-U585666 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31410 [Download][View] Facility Assigned ID: TCAFQ71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5