EST details — SGN-E208429

Search information 
Request: 208429Match: SGN-E208429
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7155Clone name: cLEC-37-P7
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174170 is on microarray TOM1: SGN-S1-1-1.1.16.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174170 [TUS-18-A16] Trace: SGN-T1304 EST: SGN-E378745 Direction: 5' Facility: Giov. Lab
Clone: SGN-C174170 [TUS-18-A16] Trace: SGN-T189183 EST: SGN-E376569 Direction: 3' Facility: INRA
Clone: SGN-C174170 [TUS-18-A16] Trace: SGN-T189184 EST: SGN-E376570 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208429Length: 589 bp (766 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208429 [] (trimmed) TGAAACTACTTGCATAGTCTTTCCAACTTGTTTACAAGTGCTGGTTTTTAGTTGGTGGTCACATAAACAACTTCATTTTTGTTGTTTTTTTGACT
TCCAAGAACGTGGGTGCCTTGCCTTATATCCTTCTAACTTCTGAAAAAACCTACTGATAATGACAAAAATAAGCATGATCTTTTTAGTCTAGTGA
GAATTGACATTTTAGTTTTCTATATAGGATTAGTGAGGGGTCTAGTAAAAACAAGTAGCCAAATTGTGTTACTTCACTTCCCTTAAGTTCTATAA
GTACTCTGTTTTAGTTTAAAAAAGCTATACTAGCTGGACACAAATTATGGAATTCACTAGATTTTGCTTCTTGGTTTTTTCTGTTTTCTTGATTT
CCTATGTTTTTTCAGTTCATGGTAGGTTTTATGATTACCCCAAAGTGTCGCGTTTTCGTGCATTGTCACAAATATCAATGCCACCTTTCCCTGCC
CCTGCCCCTGGCCCTGGCCCTGCCCCTGCTCCTGAACCTAAGGGTGATCCAAAAACTGAGAATGTGAAGAATTCATCAAATGATTATGCAGCAAG
CATTTTCAATGTGTTGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208429] SGN-U581408 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31420 [Download][View] Facility Assigned ID: TCAFQ88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5