EST details — SGN-E209071

Search information 
Request: 209071Match: SGN-E209071
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7371Clone name: cLEC-38-L14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174228 is on microarray TOM1: SGN-S1-1-7.4.16.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174228 [TUS-18-D2] Trace: SGN-T197309 EST: SGN-E395983 Direction: 3' Facility: INRA
Clone: SGN-C174228 [TUS-18-D2] Trace: SGN-T197310 EST: SGN-E395984 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209071Length: 173 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E209071 [] (trimmed) AGCTTCCTCTCAATCCCCGCGTTAATAATTGAACGCTCACATTCTCTCCCGGCTTCTTCTCTCTTTCACACATTTACACAAGTACTGGTAATACC
TTTCAATAGAGAGGGAGAAGGAGATAACAGAGGAATCAAGATCCAAAAAAATGGGGTCTCTTCCACCACCATATCGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209071] SGN-U570038 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31606 [Download][View] Facility Assigned ID: TCAFV67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5