EST details — SGN-E209981

Search information 
Request: 209981Match: SGN-E209981
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7755Clone name: cLEC-40-C16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183599 is on microarray TOM1: SGN-S1-1-4.2.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183599 [TUS-42-J13] Trace: SGN-T196201 EST: SGN-E394875 Direction: 3' Facility: INRA
Clone: SGN-C183599 [TUS-42-J13] Trace: SGN-T196201 EST: SGN-E399397 Direction: 3' Facility: INRA
Clone: SGN-C183599 [TUS-42-J13] Trace: SGN-T200371 EST: SGN-E399398 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209981Length: 471 bp (660 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E209981 [] (trimmed) CACGTTATTATTTGTTCAATTTTACACTAATTTAAGATACAATTAGAGGTGCATAGATATCAAAAATCATGACTTGTGAATTTTACCTCTTACAA
TTAACATATAACCATTTATACAAGAACAACAACAACAACTATGGCCTTTCCATTTCCACACAAATTAAAAATCATACTTCTCATGACTTGTGAAT
TTTACCTCTAAGTTTAACACCAAGAACGTTCTCCATTTTCCCCAACACTAGTTGATTAGGCACTGCCTTACCATTCTCATACTCGGCAACAACCT
GCGTCCTTTCATTGATCTTCTTCGCTAGATCAGCTTGGCTCATCTTCTTCTCAATCCGCGCTTTCTGTATTGCTTGCCTTACACCCACCGGCAAT
TTCTCAAGTGCCGCTGGTTCCGCCGCCTCATCTAGCTTTCTTACATTAACTGCCAACGTCGCCGCCTTCTTATTCAAACCAGCGTCGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209981] SGN-U566716 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32045 [Download][View] Facility Assigned ID: TCAGB20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5