EST details — SGN-E210096

Search information 
Request: 210096Match: SGN-E210096
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7953Clone name: cLEC-40-M24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174323 is on microarray TOM1: SGN-S1-1-8.4.16.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174323 [TUS-18-H1] Trace: SGN-T199854 EST: SGN-E398528 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210096Length: 542 bp (664 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210096 [] (trimmed) CCAAGATGGTGTAAAACTCTTTGCTCTCAAGGTTAGTCTTCTCTTCTTTAGATTCATGGACTTCATTCACATTTATATTTGATAATAAATAAATA
TTGCATAGAACATTTTGAACGTTGGGAACAAGCAGCAGGCTGCTAAGGCTTTCTAAACATTCTTTGCATTAGAGGCGGAGCCAGAATTTTTAATA
AGGGGGTTCAAAATGTGTAGAAAATAGACACAAGAAGTAGCCGAAAGGGGTTCGACATTTACTATACATACATATAAAATTAGTTTGACCATGTA
TAAATAATACAATTTTTCGCCGAAGGAACCCCCTTCGTACAAGGTGGCTCCGCCCCTGCTGGGCATCAAGCAAAAGTAGGATAAACATGATGCCA
GATACTTCTCATTGATGAATGAATTTCTCAAAGAGAATTGATAACATAACAAAGTCATAGCAAGAAGTGGTTTTGGGGAAGCAAAAGGGCACTAA
GATTATTCCTATATATATCCTCAATTTGCTTAGTCAAAATTTCAATGCACATGATTCTGCATGTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210096] SGN-U574455 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32160 [Download][View] Facility Assigned ID: TCAGB84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5