| SGN ID: SGN-C6294 | Clone name: cLEC-35-A10 |  | Order Clone |
|
| Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: Alias clone
SGN-C173873 is on microarray TOM1: SGN-S1-1-2.1.18.20
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E210290 | Length: 263 bp (867 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E210290 [] (trimmed)
CACACTTTTAGCCCTCCATAAACTTCTACACGCTGAACCCTACTACTGCCATTGACACTTTTATTAGGCCCATTTCCGCTATTTCAATTAGTCCT
AGGCAGTTGAACGCCGTCGTACGGGGCAGAAGATCGAGTATCGTCGGTGTTTCAACCATGGCCAGCGGAGGTGAAAATCCAGTTACATTTCATTT
AACTCCATCGAGCTTGGGGAAGATTCACAAAGGTGATATTACTCACTGGTCCGTAAGATGGATCCTCTGACGC
[BLAST] [AA Translate]
| SGN-ID: SGN-T30638 [Download][View] |
Facility Assigned ID: TCAFH05TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.990 |
Expected Error Rate: 0.0427 |
Quality Trim Threshold: 14.5 |